In this study we sought to determine the expression of calpain-10 and calcium/calmodulin-dependent kinase alpha (CamKIIα) in relation to Alzheimer-type pathology in a population-based study. Using post mortem temporal cortex samples derived from the Medical Research Council Cognitive Function and Ageing Study (MRC-CFAS) ageing brain cohort we examined calpain-10 and CamKIIα gene and

protein expression using quantitative polymerase chain reaction and immunohistochemistry. We demonstrate that astrocytic expression of calpain-10 is up-regulated, and CamKIIα down-regulated with increasing Braak stage. Using immunohistochemistry we confirm protein expression of calpain-10 in astrocytes throughout the temporal cortex and demonstrate that calpain-10 click here immunoreactivity is correlated with both local and global measures of Alzheimer-type pathology. In addition, we identify a subpopulation of calpain-10 immunoreactive interlaminar astrocytes that extend processes deep into the cortex. CamKIIα is predominantly neuronal in localization and is associated with the presence of diffuse plaques in the ageing brain. Dysregulated expression of key calcium signalling molecules

occurs with progression of Alzheimer-type pathology in the ageing brain, highlighting the need for further functional studies of astrocytic calcium signalling with respect to disease progression. “
“L. Zhan, J. R. Kerr, M.-J. Lafuente, A. Maclean, M. V. Chibalina, B. Liu, B. Burke, S. Bevan and J. Nasir (2011) Neuropathology and Applied Neurobiology37, 206–219 Altered expression and coregulation Selleckchem PCI 32765 of dopamine signalling genes in schizophrenia and bipolar disorder Introduction: Signalling through dopamine receptors Etoposide is of critical importance in the brain and is implicated in schizophrenia and bipolar disorder, but its underlying molecular mechanisms remain poorly understood. Materials and methods: Using a yeast two-hybrid approach, we previously identified 11 novel dopamine receptor-interacting

proteins. Here we compare gene expression levels for 17 genes [including all 11 dopamine receptor interacting proteins, all 5 dopamine receptors (DRD1–DRD5) and DARPP-32] by real-time polymerase chain reaction, using prefrontal cortex post mortem brain samples from 33 schizophrenic, 32 bipolar disorder and 34 control subjects. Results: The expression of C14ORF28, GNB2L1, MLLT3, DRD2 and DARPP-32 genes was altered in schizophrenia and/or bipolar disorder samples relative to controls (P < 0.05). Hierarchical clustering analysis revealed the expression of these five genes (C14ORF28, GNB2L1, MLLT3, DARPP-32, DRD2) is closely correlated in patients. However, in controls, DRD2 expression in relation to the other genes appears to be very different, suggesting abnormal DRD2 activity is an important trigger in the pathophysiology of schizophrenia and bipolar disorder.

Cells were maintained in Dulbecco’s modified Eagle’s minimal essential medium (Invitrogen, Frederick, MD) supplemented with 10% fetal bovine serum (Hyclone, Logan, UT). Stat1 constructs (Stat1α and Stat1β) were a kind gift from Dr D. Levy, New York University Medical Center, NY. Stat1α-Y701F, Stat1α-S727A, Stat1α-Y701F/S727A and Stat1β-Y701F were Dinaciclib concentration generated by site-directed mutagenesis using the QuikChange mutagenesis

kit (Agilent, Santa Clara, CA). Constructs were subcloned into the pcDNA 3.1+ plasmid which carries the hygromycin resistance gene (Invitrogen). Transfections were carried out using Lipofectamine LTX (Invitrogen) according to the manufacturer’s protocols. Stable transfectants were selected and maintained in medium supplemented with 400 μg/ml of hygromycin (Invitrogen). All constructs were verified by sequencing (Genewiz, South Plainfield, NJ). Cells were stimulated with mouse IFN-γ (100 μ/ml; Peprotech, Rocky Hill, NJ) for 24 hr and whole-cell protein extracts were prepared with the addition of protease inhibitors (Roche Diagnostics, Nutley, NJ) and phosphatase

inhibitor cocktails 1 and 2 (Sigma-Aldrich, St. Louis, MO). Protein quantification was carried out using the bicinchoninic acid (BCA) assay (Pierce, Rockford, IL). For Western blotting to detect GILT protein, 5 μg/lane of protein extract was loaded onto 15% sodium dodecyl sulphate (SDS)-polyacrylamide gels. Proteins were transferred onto poly(vinylidene difluoride) https://www.selleckchem.com/ferroptosis.html (PVDF) membranes. Primary antibodies used for detection were GILT (rabbit polyclonal antiserum; M. Maric), actin (Sigma-Aldrich), total STAT1 Endonuclease (Cell Signaling, Danvers, MA). Anti-rabbit horseradish peroxidase (HRP)-conjugated secondary antibody (Jackson Immunoresearch, West Grove, PA) was used. Detection was carried out using the ECL plus reagent (PerkinElmer,

Gwaitham, MA). The sequences of the 5′ biotinylated oligonucleotides (IDT, San Diego, CA) used for the DNA affinity precipitation assay (DAPA) were as follows: STAT1 GAS Site Probe 1, GCGGAGCCTTCAGGAAAGGAGTCCCAGG and STAT1 GAS Site Probe 2, CACACTCAGTTGCTGGAAGCAAGTACCTCA; and the non-biotinylated oligonucleotides used were Stat1 consensus, TCGAGCCTGATTTCC-CCGAAATGAGGC and p53, TCCGAACAAGTCCGGGCATATGT. Complementary oligonucleotides were mixed with the above-mentioned sequences and annealed. Five-hundred micrograms of whole-cell lysate was incubated with 900 pmol of biotinylated oligonucleotide, and the complex was immunoprecipitated using streptavidin-conjugated agarose beads (Millipore, Temecula, CA), based on a previously described protocol.12 Oligonucleotide competition assays were performed using either a 10-fold or a 50-fold excess of nonbiotinylated DNA oligonucleotides. Proteins were eluted from streptavidin-conjugated agarose beads and analyzed by Western blotting, after SDS-PAGE (12% gel).

IECs were recognized early on as one of the few cell types in the body

with constitutive surface expression of NKG2D ligands [12]; however, the level of NKG2D ligand expression on IECs is not uniform, and higher surface expression has generally been observed in the colon compared with that in the small intestine [13]. The ligands are recognized by the activating NKG2D receptor expressed on NK cells, most human CD8+ T cells and activated CD8+ T cells from mice [11, 14, 15], but the NKG2D receptor can also be expressed by γδ T cells and certain activated CD4+ T cells [16], one example being CD4+ T cells from Crohn’s disease patients [3]. The regulation of NKG2D ligand surface expression has been intensely studied. However, a unifying controlling mechanism, if one exists, KU-57788 molecular weight has not yet been established. It is clear that NKG2D ligand expression is regulated at multiple levels. Heat shock, DNA damage, CMV infection, and exposure to histone deacetylase inhibitors and propionic

bacteria induce transcriptional Selleckchem SB203580 activation of NKG2D ligands in mice and human cells [8, 17-22]. Which of the ligands are induced by a specific stimulus, however, is highly dependent upon the cell type and its activation state. In addition, Nice et al. [23] have shown that the murine Mult1 protein is further regulated at the posttranslational level through ubiquitination-dependent degradation. Several forms of cancer are also recognized for their ability to shed surface NKG2D ligands in soluble forms by proteolytic cleavage [24], and Ashiru et al. [25] recently showed that the most prevalent MICA allele (MICA*008) can be directly shed in exosomes from tumors. Gene regulatory mechanisms inhibiting the NKG2D/NKG2D ligand system are less elucidated. The transcription factor Stat3 is often over-expressed by tumor cells [26] and has been shown to inhibit the MICA promoter activity in HT29 colon carcinoma cells through direct interaction [27]. It is also widely recognized that TGF-β downregulates the NKG2D expression on both

NK and CD8+ T cells [28, 29]. Several studies in recent years have demonstrated that different classes of commensal gut microorganisms (e.g. segmented filamentous bacteria) critically affect mucosal SDHB immunity [30, 31]. In addition, altered gut microbiota composition and failure to control immunity against intestinal bacteria has been linked to the development of inflammatory bowel disease [32]. A simultaneous increase in NKG2D ligands on IECs in these patients [3], and the observed attenuation of colitis in mice following inhibition of the NKG2D receptor function suggest a commensal-regulated modification of NKG2D ligands expression that may be involved in the induction of mucosal inflammation during these diseases [4, 33].

“
“Over 100 mutations have been described in the presenilin-1 gene (PSEN1), resulting in familial Alzheimer disease (AD). However, of the limited number of autopsy cases, only one has been reported from an AD family with an L420R PSEN1 mutation. AZD1208 cell line We

describe here clinical and neuropathological features of a patient with dementia-parkinsonism from a family with a PSEN1 mutation (L420R). A 43-year-old Japanese woman was autopsied 12 years after the onset of her progressive dementia and 4 years after the onset of parkinsonism. Throughout the neocortex and hippocampus, cotton wool plaques were identified, densely packed, in almost all the cortical layers along with neuronal loss, gliosis, NFT and neuropil threads. In addition, CAA affecting meningeal, subpial and cortical arterioles was found, as well as amyloid β-protein (Aβ)-deposition in the capillaries (capillary CAA) in the neocortex

and subcortical nuclei. There was loss of pigmented neurons in the substantia nigra. The putamen was densely packed with diffuse plaques and rarely showed capillary CAA, whereas the globus pallidus showed extensive capillary CAA but no plaques. This differential distribution is similar to that reported for a previous patient HM781-36B with a mutation in PSEN1. It is concluded that neuropathological changes in the substantia nigra and lenticular nuclei were responsible for the patient’s parkinsonism. Capillary transport of Aβ unique to the respective tissue of the patient may result in the differential distribution of Aβ between the putamen and globus pallidus seen in individuals with a PSEN1 mutation. “
“H. C. Yu, S. F. Feng, P. L. Chao and A. M. Y. Lin (2010) Neuropathology and Applied Neurobiology36,

612–622 Anti-inflammatory effects of pioglitazone on iron-induced oxidative injury in the nigrostriatal dopaminergic system Aims: Transition metals, oxidative stress Loperamide and neuroinflammation have been proposed as part of a vicious cycle in central nervous system neurodegeneration. Our aim was to study the anti-inflammatory effect of pioglitazone, a peroxisome proliferative activated receptor-γ agonist, on iron-induced oxidative injury in rat brain. Methods: Intranigral infusion of ferrous citrate (iron) was performed on anaesthetized rats. Pioglitazone (20 mg/kg) was orally administered. Oxidative injury was investigated by measuring lipid peroxidation in the substantia nigra (SN) and dopamine content in the striatum. Western blot assay and DNA fragmentation were employed to study the involvement of α-synuclein aggregation, neuroinflammation as well as activation of endoplasmic reticulum (ER) and mitochondrial pathways in iron-induced apoptosis. Results: Intranigral infusion of iron time-dependently increased α-synuclein aggregation and haem oxygenase-1 levels. Furthermore, apoptosis was demonstrated by TUNEL-positive cells and DNA fragmentation in the iron-infused SN.

Subsequently, we investigated the antigen-presenting potential of pe-DCs by determining the surface expression levels of the major co-stimulatory molecules. The expression of CD80, CD86 and the class II (I-a) molecules appeared down-regulated on pe-DCs of AE-infected mice, whereas CD40 remained significantly expressed on both pe-DCs of early and late stage AE-infection.

Taken together, pe-DCs resulting from the interaction with metacestodes-infected tissue expressed a high level of mRNA of TGF-β and have a low mature statute. On line with our findings, it had been previously demonstrated that immature OTX015 DCs did not mature in the presence of unfractionated E. multilocularis proteins (Em-Ag) (13). It is generally accepted that DCs recognize bacterial or viral pathogens

through toll-like receptors (TLRs) that subsequently induce IL-12 secretion (31) and increase co-stimulatory molecules (5). These DCs are able to direct T-cell differentiation towards Th1 cells (32). It has been found that upon helminth infection, Th2 cell differentiation predominates (33), but how DCs intervene in this type of immune response is not definitely clear. In our model, the finding that IL-4 gene expression of CD4+ pe-T cells was higher than IFN-γ indicated a Th2 polarization of the immune response within the peritoneal cavity of AE-infected mice. This finding raised the question whether TGF-β-secreting DCs with a relatively immature status can play a role in promoting a Th2-oriented response. The data acquired so far suggested three possibilities to explain the ability of pe-DCs from AE-infected Apoptosis Compound Library ic50 mice to prime Th2 responses: First, AE-pe-DCs that did not undergo any major activation in the presence of metacestode antigens presented a reduced expression level of co-stimulatory molecules. These cells with a low maturation profile were sufficient to drive the development of a Th2 response.

Similarly, the filarial Acanthocheilonema viteae (ES-62) antigen plus OVA-pulsed DCs had been found to prime naive DO.11.10 CD4+ T cells to Th2 type of cells, which occurred in the absence of increased MHC class II and co-stimulatory molecule expression (7). In other studies, DCs Obeticholic Acid clinical trial exposed to Schistosoma mansoni soluble egg antigen (SEA) (8) or the schistosome-associated glycan lacto-N-ficopentaose III (LNFPIII) (9) exhibited a phenotype similar to immature DCs, failing to up-regulate expression of CD80, CD86, Cd40, CD54 or OX40L. These cells produced no detectable IL-4, IL-10 or IL-12 and displayed only a minor increase in MHC class II molecule expression. In these studies, helminthic antigens in general did not appear to induce IL-12 production by DCs (8,10). Similarly, in our study, IL-12 gene expression levels of AE-DCs remained very low. These findings supported a second possibility that the Th2 immune response appeared as a default that occurred in the absence of IL-12 production (12).

The effect of perioperative transfusion of old RBCs on postoperative complications after free muscle sparing transverse rectus abdominis myocutaneous (TRAM) flap surgery was retrospectively

investigated. Two hundred sixty-one patients undergoing breast reconstruction were assigned to two groups: no transfusion and transfusion groups. Transfused patients were further divided according to the RBC storage duration (fresh, ≤14 days; old, >14 days). Postoperative complications such as vascular Mdm2 inhibitor thrombosis, hematoma, and flap congestion were noted. Patients who received old blood (n = 34), compared with those received fresh blood (n = 40) or no transfusion (n = 187), had a higher incidence of postoperative complications (44.1% vs. 20.0% or 12.8%, P < 0.05). Perioperative transfusion of old RBCs can be associated with an increase in postoperative complications after free muscle sparing TRAM flap surgery. © 2014 Wiley Periodicals, Inc. Microsurgery 34:434–438, 2014. "
“Lower abdominal, perineal, and check details groin (LAPG) reconstruction may be performed in a single stage. Anterolateral thigh (ALT) flaps are preferred here and taken as fasciocutaneous (ALT-FC), myocutaneous (ALT-MC), or vastus lateralis myocutaneous (VL-MC) flaps. We aim to present the results of reconstruction from a series of patients and guide flap selection with an algorithmic approach

to LAPG reconstruction that optimizes outcomes and minimizes morbidity. Lower abdomen, groin, perineum, vulva, vagina, scrotum,

and bladder wounds reconstructed in 22 patients using ALT flaps between 2000 and 2013 were retrospectively studied. Five ALT-FC, eight ALT-MC, and nine VL-MC flaps were performed. All flaps survived. Venous congestion occurred in three VL-MC flaps from mechanical cause. Wound infection occurred in six cases. Urinary leak occurred in three cases of bladder reconstruction. One patient died from congestive heart failure. The ALT flap is time tested and dependably addresses most LAPG defects; flap variations are suited for niche defects. We propose a novel algorithm to guide reconstructive decision-making. Silibinin © 2014 Wiley Periodicals, Inc. Microsurgery, 2014. “
“Introduction. As peripheral nerve specialists can have a wide variety of training backgrounds, few standards of care exist with respect to necessary incision length, amount of dissection, and operative technique for common nerve decompressions. Methods. Approaches for the following 12 common peripheral nerve surgeries were minimized using shorter incisions and a simple lighted retractor: zygomatico-temporal and auriculotemporal, greater occipital, brachial plexus, ulnar, radial, median, lateral femoral cutaneous nerve of the thigh, peroneal at the groin, fibular neck and lateral calf, and tibial and inner ankle. The new “minimal” incision length was recorded as was that of the “classical” approach as taught to the senior author and frequently represented in atlases.

The starter culture was diluted at 1 : 100 in HI broth and grown with shaking at 33 °C to an OD610 nm of ∼0.5 (exponential growth phase). Bacteria were collected by centrifugation, washed once with phosphate-buffered saline (PBS) (Sigma, St. Louis, MO), suspended in PBS and inactivated by overnight incubation at 25 °C with neutral buffered formalin (0.5% final concentration) (Sigma). The cells were washed twice with PBS and stored at 4 °C. Formalin treatment was used to inactivate V. vulnificus because growth would confound assay results due to cytotoxicity (Shin et al., 2004). Vibrio vulnificus (CFU mL−1) were quantified by plating aliquots of serial

dilutions on HI agar before formalin treatment. Blood was collected aseptically from two to three male mice (10–13 weeks of age) per each genotype (i.e. WT, TLR4 KO, and MyD88 KO) in heparin-flushed Apoptosis Compound Library chemical structure TGF-beta inhibitor syringes and pooled to minimize variability. Mouse blood (25 μL) was diluted to 200 μL with Roswell Park Memorial Institute

(RPMI) medium 1640 (Invitrogen Corp., Grand Island, NY) (negative control), RPMI medium containing formalin-inactivated V. vulnificus ATCC 27562 cells, or RPMI medium containing 20 ng (100 ng mL−1) Escherichia coli 0111 : B4 purified lipopolysaccharide (Sigma) (positive control). Duplicate samples were incubated at 34 °C with gentle agitation for 6 and 24 h. Cell-free supernatants were collected following centrifugation and assayed in duplicate for mouse TNFα with a commercial enzyme-linked immunosorbent assay (ELISA) kit (R&D Systems Inc., Minneapolis, MN) at the UNC-CH Immunotechnologies Core Facility. Whole blood assays were repeated at least once. Statistical significance of results was evaluated with the unpaired, two-tailed t-test for analysis of two groups or anova for analysis of more than two groups (graphpad prism 4, GraphPad Software Inc., San Diego, CA). A P-value of <0.05 was considered significant. Splenocytes were prepared from pooled spleens of two male mice (10–12 weeks of age) per each genotype

(i.e. WT, MyD88 KO, and TLR4 KO). Following lysis of red blood cells, splenocytes were washed, suspended in RPMI medium containing 5% heat-inactivated fetal bovine serum (Fisher Scientific, Pittsburgh, PA), and seeded at 5 × 105 cells in 200 μL per well. learn more After a 24-h incubation at 37 °C in 5% CO2 with RPMI medium only, 1 × 106 formalin-inactivated V. vulnificus ATCC 27562 cells, or 20 ng E. coli lipopolysaccharide, cell-free supernatants from duplicate samples were collected and assayed in duplicate for TNFα by ELISA. Splenocyte assays were repeated an additional time. Statistical significance of results was evaluated with the unpaired, two-tailed t-test for analysis of two groups or anova for analysis of more than two groups (graphpad prism 4). A P-value of <0.05 was considered significant. Vibrio vulnificus ATCC 27562 was grown with shaking in HI broth at 33 °C to exponential phase.

These data, albeit counterintuitive, are supported by emerging evidence that the TNF-TNFR2 interaction plays a critical role in the generation, expansion and function of human and mouse Tregs 8–12. TNFR2 is constitutively expressed by human and mouse thymic Tregs 5, 13. Normal human circulating Tregs expressed markedly higher levels of TNFR2 than CD4+FoxP3−

effector T cells (Teffs) 4, 14, 15. Normally, 30–40% of the Tregs present in the peripheral lymphoid tissues of unstimulated Balb/c and C57BL/6 (B6) mice express a high level of TNFR2, while less than 10% of the Teffs express a lower level of TNFR2 3, 16. Furthermore, TNFR2-expressing Tregs exhibited the most potent suppressive activity, while TNFR2− Tregs, even though CD25+ and FoxP3+ in normal C57BL/6 mice, had only minimal or no suppressive activity 5, 16. Intratumoral Tregs are maximally immunosuppressive, Vadimezan since the majority of tumor-infiltrating Tregs were highly suppressive TNFR2+ cells 5, 16, and depletion of TNFR2+ Tregs was associated with tumor eradication after cyclophosphamide treatment 17. When transferred to LPS-challenged recipient mice, Tregs from wild-type (WT) mice were able to inhibit inflammatory responses, while Tregs from Crenolanib cost TNFR2-deficient mice failed to do so 14. In normal human peripheral blood, TNFR2-expressing CD4+CD25+

cells comprised a high level of FoxP3+ cells and were functionally suppressive 4. In malaria patients, proliferating TNFR2+ Tregs exhibited an enhanced suppressive activity 18. These studies clearly demonstrate that TNFR2 not only serves as a marker but also promotes Treg function. We have investigated the effect of TNF on TNFR2 expression on Tregs. Since TNFR2 is a member of the TNF receptor superfamily (TNFRSF) and other co-stimulatory TNFRSF members, such as 4-1BB 19 and OX40 20, also have been reported to participate in Treg activity, we also investigated their response to TNF. We found that TNF preferentially up-regulates these TNFRSF

members on Tregs, which contribute to the optimal activation of Tregs and result in attenuation of excessive inflammatory responses. To test the effect of TNF on the expression of TNFR2 and other co-stimulatory TNFRSF members on Tregs, we performed a gene profiling old assay using the Mouse Tumor Necrosis Factor (TNF) Ligand and Receptor Signaling Pathways RT2 Profiler™ PCR Array (SABiosciences, Frederick, MD, USA). This showed that, by comparison with freshly isolated Tregs or with TNF/IL-2-treated Teffs, Tregs treated with TNF/IL-2 for 12 h up-regulated their expression of genes encoding a number of TNFRSF members, including Tnfrsf1b (TNFR2), Tnfrsf4 (OX40), Tnfrsf6 (FAS), Tnfrsf9 (4-1BB) and Tnfrsf18 (GITR), by greater than ∼two-fold (data not shown). Our results are in agreement with a recent microarray study in human Tregs 15. We next performed real-time PCR assay to verify their changes in gene expression.

Outbred CD1 exhibit either Balb/c-like or C57Bl/6-like spinotrapezius angioarchitecture, predictive

of response to arteriolar ligation. Conclusions:  This collateral capillary arterialization process may explain the reported longer time required for blood flow recovery in Balb/c hindlimb ischemia, as low-resistance blood flow pathways along capillary conduits must be formed (“arterialization”) buy Lumacaftor before reperfusion. “
“Please cite this paper as: Al-Khazraji BK, Novielli NM, Goldman D, Medeiros PJ, Jackson DN. A simple “Streak Length Method” for quantifying and characterizing red blood cell velocity profiles and blood flow in rat skeletal muscle arterioles. Microcirculation 19: 327–335, HSP inhibitor drugs 2012. Objectives:  To develop a valid experimental method for quantifying blood flow in continuously branching skeletal muscle arterioles, and to derive an empirical relationship between velocity

ratio (VMax/VMean) and arteriolar diameter. Methods:  We evaluated arteriolar trees using IVVM of rat gluteus maximus muscle and developed a method to acquire single fluorescent-labeled RBC velocities across arteriolar lumens to create velocity profiles. These data were used to calculate the blood flow for 37 vessel segments (diameters: 21–115 μm). Results:  Mass balance at arteriolar bifurcations had 0.6 ± 3.2% Selleck Sorafenib error. Velocity ratios ranged from 1.35 to 1.98 and were positively correlated with diameter (p < 0.0001), and VRBC profiles were blunted with decreasing diameter. Conclusions:  We present a means for quantifying blood flow in continuously branching skeletal muscle arterioles. Further, we provide an equation for calculating

velocity ratios based on arteriolar diameter, which may be used by others for blood flow calculations. “
“Please cite this paper as: Fedosov, Caswell, Popel and Karniadakis (2010). Blood Flow and Cell-Free Layer in Microvessels. Microcirculation17(8), 615–628. Blood is modeled as a suspension of red blood cells using the dissipative particle dynamics method. The red blood cell membrane is coarse-grained for efficient simulations of multiple cells, yet accurately describes its viscoelastic properties. Blood flow in microtubes ranging from 10 to 40 μm in diameter is simulated in three dimensions for values of hematocrit in the range of 0.15–0.45 and carefully compared with available experimental data. Velocity profiles for different hematocrit values show an increase in bluntness with an increase in hematocrit. Red blood cell center-of-mass distributions demonstrate cell migration away from the wall to the tube center. This results in the formation of a cell-free layer next to the tube wall corresponding to the experimentally observed Fahraeus and Fahraeus–Lindqvist effects.

While there is a great deal that we do not understand about the biology of HIV transmission, we do know biological factors are critical determinants of exposure outcome.21,22 The most important determinants of transmission are (i) the HIV level in the blood and genital/rectal secretions of the HIV-infected partner and (ii) the number and density

of HIV-susceptible target cells to which the virus can gain access at the site of exposure (usually the mucosal lining of the penis, rectum or female genital tract) in the HIV-uninfected partner.23,24 As will be discussed, these two critical determinants are affected by numerous, overlapping biological factors: we hypothesize that this biology, in addition to any sociocultural and economic factors, has played and continues to play an important role in the racial imbalance that characterizes the global HIV pandemic. Important biological factors and the potential interactions of these factors with race NVP-BGJ398 cell line and geography are now reviewed under the broad headings of viral factors, host genetic factors, co-infections and host immunology. HIV-1 group M viruses are subdivided into several subtypes or clades based on genetic heterogeneity: these clades have strong geographical associations,25

and considerable research has examined the potential associations of clade with HIV transmission. Clade C predominates globally and is responsible for most HIV infections in southern Africa and India, while clade B predominates in North America, Europe and Australia. East Africa is dominated Ku-0059436 clinical trial by clade A and to a lesser extent D, while the recombinant virus designated CRF01_AE (previously clade Idoxuridine E) is most common in Thailand. Early studies suggested that clade C and CRF01_AE were more easily transmitted through heterosexual sex,26 potentially because they bound preferentially to Langerhans cells in the vaginal mucosa and penis.27 Research continues in this area, and more recent work has found that HIV clade C shows enhanced replication (compared to clade A) in a dual virus culture system, as well as in an ex vivo cervical explant model;28

in addition, observational studies demonstrate that clade A may be transmitted more easily than clade D.29 While these data are interesting, it is probably fair to say that it remains unclear what effect, if any, virus clade has on patterns of HIV epidemic spread in the real world. Certainly, virus subtype cannot explain racial differences in HIV prevalence that are apparent in multiple regions and across different virus clades. The clearest association of viral factors with HIV transmission is the plasma HIV RNA viral load, with higher plasma levels being associated with stepwise increases in the probability of transmission30 and in virus levels within genital secretions.21 There are a few data to suggest that plasma viral load varies substantially with viral clade, geography or race per se.