Wild-type PA68 and pfm mutant strain (I69) were cultured at 37 °C buy Talazoparib in a rotating shaker at 200 rpm overnight. The culture was diluted to OD600 nm = 0.05 with fresh LB medium and grew at 37 °C, 200 rpm for 6 h. RNA samples were prepared at OD600 nm = 1.5 by Tianjin Biochip Corporation (China) who also provided both technical and bioinformatic analyses. The transcriptional profiles of the clinical strain PA68 and I69 were analyzed using Affymetrix P. aeruginosa DNA chip, and microarray data were analyzed following the manufacturer’s recommendation (www.affymetrix.com). Target signals of probes used to test the transcription level were set to 500. Two independent experiments were performed. Student’s t-test
was applied to analyze the significance of individual transcripts Z-IETD-FMK ic50 (The microarray data shown in this study corresponded to P value < 0.05). Semiquantitative RT-PCR was used to confirm the results. Primer pairs: lasR-s, CAGAAGATGGCGAGCGACC and
lasR-anti, ATGGACGGTTCCCAGA AAATC; lasI-s, CAAGTTGCGTGCTCAAGTGTT and lasI-anti, AGTTCCCAGATGTGCGGC; rhlR-s, CCTGGAAAAGGAAGTGCGG and rhlR-anti, CTCCAGACCACCATTTCCGA; rhlI-s: CGCAAACCCGCTACATCG and rhlI-anti: TGCAGGCTGGACCAGAATAT were used to monitor the expression level of lasR, lasI, rhlR, and rhlI, respectively. The principal sigma-factor gene rpoD was selected as the control. The primer pair: rpoD-s: CCTGGCCGAGCTGTTCATG, rpoD-anti: TCGTCGGTCTCGTGGTTCG was used. To construct the lasI’-lacZ operon fusion, 487-bp fragment, upstream of lasI coding sequence, including the potential lasI promoter, was ligated into of pDN19lacΩ between EcoRI and BamHI restriction sites (the plasmid harboring promoterless lacZ). Similarly, rhlI’-lacZ reporter that
harbored 559-bp DNA fragment including the potential rhlI promoter, lasR’-lacZ reporter that harbored 660-bp DNA fragment including the potential lasR promoter, and rhlR’-lacZ reporter that harbored 742-bp DNA fragment including the potential rhlR promoter were constructed. Acyl homoserine lactones were detected using a method modified from a previous report (Teasdale et al., 2009). The P. aeruginosa 3-oxoacyl-(acyl-carrier-protein) reductase cultures were grown overnight and pelleted by centrifugation at 10 000 g for 10 min. One mL of the cell-free culture supernatant was collected for further experiments. Meanwhile, 1 mL culture of indicator strain JB525-gfp (ASV; E. coli MT102 harboring recombinant plasmid pJBA132) (Wu et al., 2000) was centrifuged at 10 000 g for 10 min. The JB525-gfp (ASV) cell pellet was resuspended with the supernatant of P. aeruginosa culture. The suspension was then incubated at 30 °C for 90 min with shaking. Fluorescence intensity of the suspension was measured by fluorescence spectrophotometer (λ = 480 nm excitation, λ = 515 nm emission) to indicate the relative amount of AHLs in the supernatant of P. aeruginosa culture. The biosensor strains E.