08 ��M zebrafish ��-actin 1 primers (forward primer: 5��-GTA TCC ACG AGA CCA CCT TCA; reverse primer: 5��-GAG GAG GGC AAA GTG GTA AAC). These conditions avoid saturation of the PCR products selleck bio and were determined in preliminary separate RT-PCR reactions for each couple of primers. Primers were from MWG-BIOTECH AG (Ebersberg, Germany). The expected multiplex RT-PCR products were a 549 base pair (bp) amplicon for zebrafish ��-actin 1 mRNA and a 1380 bp amplicon for zebrafish CD mRNA. The RT-PCR products were analyzed by agarose gel electrophoresis. DNA ladder was purchased from Fermentas (O’GeneRuler DNA Ladder Mix, Fermentas). Quantitative Real Time RT-PCR Total RNA was extracted as described above and the cDNA was synthesized by QuantiTect SYBR Green RT-PCR (Qiagen, Hilden, Germany) according to manufacturer’s protocol.

qReal Time RT-PCR experiments were performed according to QuantiFast SYBR Green PCR protocol (Qiagen). ��-actin 1 was chosen as reference gene. The primers used were QT02072287 for zebrafish CD and QT02174907 for zebrafish ��-actin, purchased from Qiagen. 75 ng of template was used in each reaction. For the negative control, DDH20 RNASE-DNASE free (Qiagen) was used instead of template cDNA. Two independent experiments, each run in triplicate, were performed using an Applied Biosystems Abi Prism 7000 Sequence Detection System (SDS) (Applied Biosystems, Foster City, CA, US). Amplification was done according to the cycling program of QuantiFast SYBR Green PCR (Qiagen) followed by a dissociation stage according to Abi Prism 700 SDS for the Sybr Green assay.

Amplification and dissociation curves generated by the SDS 1.1 software were used for gene expression analysis. Ct values were obtained for each reaction and the average was calculated. The relative mRNA expression of each transcript was calculated according to the comparative 2-Delta-Delta-Ct method [70] and the value stood for an n-fold difference relative to the calibrator. UFE ��Ct served as calibrator (relative gene expression values for calibrator were set to 1). Entinostat Data are given as average �� SD. The Student’s t test was employed for statistical analysis. A p<0.05 value was assumed as significant. Full length cloning of zebrafish Cathepsin D Zebrafish CD cDNA was generated by RT-PCR using 10 ��M of primers (forward primer: CATATTAGACCGCACAACAATAA, reverse primer: ATCATCATAATGCTAAACTCCGT), subcloned into the plasmid pcDNA 3.1 Zeo (Invitrogen Co) and subjected to automated sequencing (ABI PRISM 3100, Applied Biosystems). Primers were from MWG-BIOTECHAG. The plasmid carrying the human CD cDNA has already been described [41].